col7a1l

Ensembl ID:
ENSDARG00000069692
ZFIN ID:
ZDB-GENE-030131-9861
Description:
Novel protein similar to vertebrate collagen family [Source:UniProtKB/TrEMBL;Acc:Q1LYN6]
Human Orthologues:
COL24A1, COL27A1
Human Descriptions:
collagen, type XXIV, alpha 1 [Source:HGNC Symbol;Acc:20821]
collagen, type XXVII, alpha 1 [Source:HGNC Symbol;Acc:22986]
Mouse Orthologues:
Col24a1, Col27a1
Mouse Descriptions:
collagen, type XXIV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1918605]
collagen, type XXVII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2672118]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6935 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3473 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101592 None None 589 None 14
ENSDART00000141566 Essential Splice Site 1067 1722 22 64
Genomic Location:
Chromosome 4 (position 14987750)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCAGAAGCTCTTGCTAAACCAGAAGGACCTTGTCCGCTTAAYTGCAAG[G/A]TAAATGCTTTCTCTGACAAATGTTATCTCGATGTTACTGTATTTTTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3473
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101592 None None 589 None 14
ENSDART00000141566 Essential Splice Site 1156 1722 28 64
Genomic Location:
Chromosome 4 (position 14990977)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGGGCCTCCTGGTAATACTGGACCTAAAGGACAGAGAGGAGAGAGAG[T/C]AAGTTCAGGCACMGACRACCGTGTTATGTGGTGTATAATTGTGTTTACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rcqxtg03