adra2c

Ensembl ID:
ENSDARG00000069669
ZFIN ID:
ZDB-GENE-021010-3
Description:
Alpha-2C adrenergic receptor [Source:UniProtKB/Swiss-Prot;Acc:Q90WY6]
Human Orthologue:
ADRA2C
Human Description:
adrenergic, alpha-2C-, receptor [Source:HGNC Symbol;Acc:283]
Mouse Orthologue:
Adra2c
Mouse Description:
adrenergic receptor, alpha 2c Gene [Source:MGI Symbol;Acc:MGI:87936]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30804 Nonsense Mutation detected in F1 DNA During 2016
sa39656 Nonsense Mutation detected in F1 DNA During 2016
sa39655 Nonsense Mutation detected in F1 DNA During 2016
sa19542 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101562 Nonsense 224 432 1 1
ENSDART00000101562 Nonsense 224 432 1 1
Genomic Location (Zv9):
Chromosome 1 (position 41374520)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40290761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCATTATGATCCTCGTTTACATCCGAATCTATCAGGTGGCTAAAACA[A/T]GAACCCGAAATATGTCTGAAAAGCGGCGGGATCCTGATGGTGGCTCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101562 Nonsense 224 432 1 1
ENSDART00000101562 Nonsense 224 432 1 1
Genomic Location (Zv9):
Chromosome 1 (position 41374520)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40290761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCATTATGATCCTCGTTTACATCCGAATCTATCAGGTGGCTAAAACA[A/T]GAACCCGAAATATGTCTGAAAAGCGGCGGGATCCTGATGGTGGCTCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101562 Nonsense 263 432 1 1
Genomic Location (Zv9):
Chromosome 1 (position 41374402)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40290643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTTAAGCCGTGAGGATTCTAGACGGGAAAATGGCCACTGTTCCTCAT[C/A]GCCAGGCGAACGCAAACCAGCCGAGGATAACCCAGACGCTGACCTCGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101562 Nonsense 426 432 1 1
Genomic Location (Zv9):
Chromosome 1 (position 41373914)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40290155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCATCTTCAACCAGGACTTCCGGCGAGCTTTTCAAAAGATCCTGTGC[A/T]AGTCCTGGAAAAGGTCTTTCTAGAGGCACCAATTTGCAGCGTCCAGTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link