ENSDARG00000069661

Ensembl ID:
ENSDARG00000069661
Human Orthologue:
HARBI1
Human Description:
harbinger transposase derived 1 [Source:HGNC Symbol;Acc:26522]
Mouse Orthologue:
Harbi1
Mouse Description:
harbinger transposase derived 1 Gene [Source:MGI Symbol;Acc:MGI:2443194]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25127 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101529 Nonsense 253 429 4 4
Genomic Location:
Chromosome 20 (position 582453)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAAATGGATGGATTCAGGTCTGCTGAACTGTCCTCCTCCTGAACCGT[T/A]GGCCAACAGTGAGCTGAAGATACCGTACATGTTTGTGGGCGATGAGACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ww5vu25k