ENSDARG00000069661

Ensembl ID:
ENSDARG00000069661
Human Orthologue:
HARBI1
Human Description:
harbinger transposase derived 1 [Source:HGNC Symbol;Acc:26522]
Mouse Orthologue:
Harbi1
Mouse Description:
harbinger transposase derived 1 Gene [Source:MGI Symbol;Acc:MGI:2443194]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43362 Nonsense Mutation detected in F1 DNA During 2016
sa36931 Nonsense Mutation detected in F1 DNA During 2016
sa25127 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101529 Nonsense 183 429 4 4
Genomic Location:
Chromosome 20 (position 582244)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGCAATTTCCACACTGCTTAGGTGCCCTTGGTGGAAAACGCATCTA[T/A]ATACAACCTCCAGCAAAAACAGGCACCTTCGATAACTATAAGGGCAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101529 Nonsense 247 429 4 4
Genomic Location:
Chromosome 20 (position 582436)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGCTCAGTCGGGCTTGTGCAAATGGATGGATTCAGGTCTGCTGAACTG[T/A]CCTCCTCCTGAACCGTTGGCCAACAGTGAGCTGAAGATACCGTACATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101529 Nonsense 253 429 4 4
Genomic Location:
Chromosome 20 (position 582453)
KASP Assay ID:
554-7405.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAAATGGATGGATTCAGGTCTGCTGAACTGTCCTCCTCCTGAACCGT[T/A]GGCCAACAGTGAGCTGAAGATACCGTACATGTTTGTGGGCGATGAGACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link