si:ch211-113p18.5

Ensembl ID:
ENSDARG00000069649
ZFIN ID:
ZDB-GENE-060503-851
Description:
Transmembrane protein 160 [Source:UniProtKB/Swiss-Prot;Acc:B3DJK0]
Human Orthologue:
TMEM160
Human Description:
transmembrane protein 160 [Source:HGNC Symbol;Acc:26042]
Mouse Orthologue:
Tmem160
Mouse Description:
transmembrane protein 160 Gene [Source:MGI Symbol;Acc:MGI:1916344]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1347 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101504 Nonsense 109 208 3 4
ENSDART00000147086 Nonsense 102 201 3 4
Genomic Location (Zv9):
Chromosome 15 (position 8472026)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 8421533
KASP Assay ID:
554-1261.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCGACAGGCATCGGCGTTATTGCCTTTGTGCAGAGTGATGTGGGCAGA[G/T]AGGCTGGATATGGTACTATATCTTATACTAGAGCTTGTAATATTATACTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link