tat

Ensembl ID:
ENSDARG00000069630
ZFIN ID:
ZDB-GENE-030131-1144
Description:
tyrosine aminotransferase [Source:RefSeq peptide;Acc:NP_001071022]
Human Orthologue:
TAT
Human Description:
tyrosine aminotransferase [Source:HGNC Symbol;Acc:11573]
Mouse Orthologue:
Tat
Mouse Description:
tyrosine aminotransferase Gene [Source:MGI Symbol;Acc:MGI:98487]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23250 Essential Splice Site Available for shipment Available now
sa13800 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101472 Essential Splice Site 128 468 3 12
Genomic Location:
Chromosome 18 (position 12642824)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGATGCAATAGATTCCCACAAATACAATGGATATGCTCCCTCTGTTGG[T/C]GAGATTGAGTTTCTCTGAAGATTAAATGCTGAAATATGTAGTAGAAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101472 Nonsense 425 468 12 12
Genomic Location:
Chromosome 18 (position 12656563)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATACTGACTGCATTCTSACCTTCATGTGGTTTCTCTCTYCAGGCATTT[G/T]AATACCCAAACTWCTTCCGAATTGTAGTGACAGTCCCRGAGGAGATGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oqeukb95