mrps18c

Ensembl ID:
ENSDARG00000069624
ZFIN ID:
ZDB-GENE-060503-609
Description:
28S ribosomal protein S18c, mitochondrial [Source:RefSeq peptide;Acc:NP_001038655]
Human Orthologue:
MRPS18C
Human Description:
mitochondrial ribosomal protein S18C [Source:HGNC Symbol;Acc:16633]
Mouse Orthologue:
Mrps18c
Mouse Description:
mitochondrial ribosomal protein S18C Gene [Source:MGI Symbol;Acc:MGI:1915985]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37276 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101462 Nonsense 133 136 6 6
Genomic Location (Zv9):
Chromosome 21 (position 18144204)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19292456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCCTGAAGGACCCACTGTTTATTCAAGACCCTGACATTTGTGGTACT[A/T]AACACGGGGAGTAGGTTCTGGATGAAGATTATTCCTGTACAAGCTGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link