ENSDARG00000069620

Ensembl ID:
ENSDARG00000069620
Mouse Orthologue:
Gm1123
Mouse Description:
predicted gene 1123 Gene [Source:MGI Symbol;Acc:MGI:2685969]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37849 Nonsense Mutation detected in F1 DNA During 2017
sa44112 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101460 Nonsense 91 1037 1 24
Genomic Location (Zv9):
Chromosome 24 (position 16354548)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11346773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTCTCCCTCCGTCTGAACAATCTGACAGCTGAAGATAAGGGAGAATA[C/A]ACGTGTACAGTTTACAGTCAGCAAAATGCTGTGTTTTCAACTAAAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101460 Nonsense 634 1037 13 24
Genomic Location (Zv9):
Chromosome 24 (position 16333521)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11325746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGCAATTCAGAGGCAGAGTTGAGTTCTTCACTGCTGAAATCCCCAAA[G/T]GAAACTTCTCTCTCAGACTGAAGAGTGTCCGAACTGAGGATAAAGAAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link