atf7ip

Ensembl ID:
ENSDARG00000069619
ZFIN ID:
ZDB-GENE-061103-178
Description:
Activating transcription factor 7-interacting protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A0JME2]
Human Orthologue:
ATF7IP
Human Description:
activating transcription factor 7 interacting protein [Source:HGNC Symbol;Acc:20092]
Mouse Orthologue:
Atf7ip
Mouse Description:
activating transcription factor 7 interacting protein Gene [Source:MGI Symbol;Acc:MGI:1858965]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3345 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6602 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101452 Essential Splice Site 253 816 4 14
ENSDART00000135089 Essential Splice Site 252 815 4 14
Genomic Location:
Chromosome 1 (position 46047366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCTGAAAATCACAGCCAACGGTGGAAACCGGGACAAAATAGAGAAG[G/A]TTTGTTATTATTTAKTGTTTAAGGGAAAGTTCACAAATTTTNCTGTAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101452 Nonsense 593 816 10 14
ENSDART00000135089 Nonsense 592 815 10 14
Genomic Location:
Chromosome 1 (position 46044439)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCATAATGTAATCNTTGTTTTATTTTTTNCTGTTGCAGMWAATCAGGCCT[C/A]GACACCAAAAACASCCTCTCAGGTAAGTCTCATTTTAAACCACGCTGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qujtuhmh