atf7ip

Ensembl ID:
ENSDARG00000069619
ZFIN ID:
ZDB-GENE-061103-178
Description:
Activating transcription factor 7-interacting protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A0JME2]
Human Orthologue:
ATF7IP
Human Description:
activating transcription factor 7 interacting protein [Source:HGNC Symbol;Acc:20092]
Mouse Orthologue:
Atf7ip
Mouse Description:
activating transcription factor 7 interacting protein Gene [Source:MGI Symbol;Acc:MGI:1858965]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32740 Nonsense Mutation detected in F1 DNA During 2016
sa3345 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6602 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101452 Nonsense 98 816 3 14
ENSDART00000135089 Nonsense 98 815 3 14
Genomic Location:
Chromosome 1 (position 46048382)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCATCTCCATCCTTCCCAGTCTCTCGATCGCCCTCTCCACCCAACACA[C/T]AGACTACCTCACCTGCGATGGATTTGGAAGACCCCCTTGTGGCCACCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101452 Essential Splice Site 253 816 4 14
ENSDART00000135089 Essential Splice Site 252 815 4 14
Genomic Location:
Chromosome 1 (position 46047366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCTGAAAATCACAGCCAACGGTGGAAACCGGGACAAAATAGAGAAG[G/A]TTTGTTATTATTTAKTGTTTAAGGGAAAGTTCACAAATTTTNCTGTAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101452 Nonsense 593 816 10 14
ENSDART00000135089 Nonsense 592 815 10 14
Genomic Location:
Chromosome 1 (position 46044439)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCATAATGTAATCNTTGTTTTATTTTTTNCTGTTGCAGMWAATCAGGCCT[C/A]GACACCAAAAACASCCTCTCAGGTAAGTCTCATTTTAAACCACGCTGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link