LOC100002543

Ensembl ID:
ENSDARG00000069608
Human Orthologues:
AKAP2, PALM2-AKAP2
Human Descriptions:
A kinase (PRKA) anchor protein 2 [Source:HGNC Symbol;Acc:372]
PALM2-AKAP2 readthrough [Source:HGNC Symbol;Acc:33529]
Mouse Orthologues:
AF064781, Akap2
Mouse Descriptions:
A kinase (PRKA) anchor protein 2 Gene [Source:MGI Symbol;Acc:MGI:1306795]
cDNA sequence AF064781 Gene [Source:MGI Symbol;Acc:MGI:3845895]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17580 Essential Splice Site Available for shipment Available now
sa6157 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15545 Essential Splice Site Available for shipment Available now
sa21643 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101431 Essential Splice Site 80 1266 4 12
Genomic Location:
Chromosome 10 (position 4778660)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCTGATGTTGATCAATGACCTSRTGGTAGAAAATRTTTCCGCCTTAC[A/C]GTCTAAAGCCATGAGGGAGAGRTGGCTTCTTCAGGGGACACCAGCGSCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101431 Essential Splice Site 203 1266 7 12
Genomic Location:
Chromosome 10 (position 4806836)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACTCCAGTCTCAGCTTCAGGGGATCATCAGCCGCCAAGAAAACCTGG[T/A]AGGTGGTTGTGKGGGCCGGTGGGAGGGGCTGGAGGGTCACGGGTTTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101431 Essential Splice Site 203 1266 8 12
Genomic Location:
Chromosome 10 (position 4811303)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCCACCCSGAGTAGACAYTAACCCACAATCATCTGCACTCTTCCCCAA[G/A]CATTATAYGCCATGGAGATCAATGTGGAGAAGGACCGGAAAACGGGTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101431 Nonsense 241 1266 8 12
Genomic Location:
Chromosome 10 (position 4811419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCGGCCGTCAGCCCGCAGGACGCTCACCAGAGGGGCGTCAAGGTCTA[C/A]GACGATGGCCGAAAAGTGATCTACGAGGTGCGTTCTGGGGGATCGACTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)
  • Type 2 diabetes: A single-nucleotide polymorphism in ANK1 is associated with susceptibility to type 2 diabetes in Japanese populations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mxyqjl6w