LOC100002543

Ensembl ID:
ENSDARG00000069608
Human Orthologues:
AKAP2, PALM2-AKAP2
Human Descriptions:
A kinase (PRKA) anchor protein 2 [Source:HGNC Symbol;Acc:372]
PALM2-AKAP2 readthrough [Source:HGNC Symbol;Acc:33529]
Mouse Orthologues:
AF064781, Akap2
Mouse Descriptions:
A kinase (PRKA) anchor protein 2 Gene [Source:MGI Symbol;Acc:MGI:1306795]
cDNA sequence AF064781 Gene [Source:MGI Symbol;Acc:MGI:3845895]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17580 Essential Splice Site Available for shipment Available now
sa6157 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15545 Essential Splice Site Available for shipment Available now
sa31762 Nonsense Mutation detected in F1 DNA During 2016
sa21643 Nonsense Mutation detected in F1 DNA During 2016
sa34819 Nonsense Mutation detected in F1 DNA During 2016
sa38773 Nonsense Mutation detected in F1 DNA During 2016
sa34820 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101431 Essential Splice Site 80 1266 4 12
Genomic Location (Zv9):
Chromosome 10 (position 4778660)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4774954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCTGATGTTGATCAATGACCTSRTGGTAGAAAATRTTTCCGCCTTAC[A/C]GTCTAAAGCCATGAGGGAGAGRTGGCTTCTTCAGGGGACACCAGCGSCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101431 Essential Splice Site 203 1266 7 12
Genomic Location (Zv9):
Chromosome 10 (position 4806836)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4803130
KASP Assay ID:
554-5134.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACTCCAGTCTCAGCTTCAGGGGATCATCAGCCGCCAAGAAAACCTGG[T/A]AGGTGGTTGTGKGGGCCGGTGGGAGGGGCTGGAGGGTCACGGGTTTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101431 Essential Splice Site 203 1266 8 12
Genomic Location (Zv9):
Chromosome 10 (position 4811303)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4807597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCCACCCSGAGTAGACAYTAACCCACAATCATCTGCACTCTTCCCCAA[G/A]CATTATAYGCCATGGAGATCAATGTGGAGAAGGACCGGAAAACGGGTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101431 Nonsense 226 1266 8 12
Genomic Location (Zv9):
Chromosome 10 (position 4811373)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4807667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGTGGAGAAGGACCGGAAAACGGGTGCCACCAAGATCCTCTCAGCCT[C/A]GGCCGTCAGCCCGCAGGACGCTCACCAGAGGGGCGTCAAGGTCTACGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101431 Nonsense 241 1266 8 12
Genomic Location (Zv9):
Chromosome 10 (position 4811419)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4807713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCGGCCGTCAGCCCGCAGGACGCTCACCAGAGGGGCGTCAAGGTCTA[C/A]GACGATGGCCGAAAAGTGATCTACGAGGTGCGTTCTGGGGGATCGACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101431 Nonsense 299 1266 8 12
Genomic Location (Zv9):
Chromosome 10 (position 4811591)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4807885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAACCAAGTGACGGAGCACGGGTGACCGTCACGCCAGCGGAGCCACAG[C/T]AAACAGGAGGACAGCTGAGCGCCAAAGAGCCCAAGCAGGACAAGAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101431 Nonsense 431 1266 9 12
Genomic Location (Zv9):
Chromosome 10 (position 4831965)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4828259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTGACTAGTGTTGTTGTTGTTTTTTGCAGGCAGTGAGAAGGCGCGTT[C/A]AGTCCTGCTGACGGCAGAGAACGGACTCTATCCATCAGCGACTGCACGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101431 Nonsense 810 1266 10 12
Genomic Location (Zv9):
Chromosome 10 (position 4892437)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4888731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCGTGCGGTTCTGTCACTGTTGCCAATCAGGAAGGGGTCACATCCTA[C/A]GATGGAAGTGAAGTTACAACAGTCAAAGCTGAAAAGATTTACTGCTGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)
  • Type 2 diabetes: A single-nucleotide polymorphism in ANK1 is associated with susceptibility to type 2 diabetes in Japanese populations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link