si:ch211-214c7.4

Ensembl ID:
ENSDARG00000069595
ZFIN ID:
ZDB-GENE-030131-6275
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BGV2]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1429 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101413 Nonsense 355 1133 4 6
ENSDART00000143363 Nonsense 355 1163 5 5
Genomic Location (Zv9):
Chromosome 1 (position 46206828)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45044340
KASP Assay ID:
554-1357.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCAGATGACAAAAAAAGTGTACCTACACGCAAGGTGCCTCCTAGTCCA[C/T]GAAACAATCCCTCACGACCAGCATCAGGCAAAAACACTGCAGCATCTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link