KIF13A

Ensembl ID:
ENSDARG00000069594
Description:
kinesin family member 13A [Source:HGNC Symbol;Acc:14566]
Human Orthologue:
KIF13A
Human Description:
kinesin family member 13A [Source:HGNC Symbol;Acc:14566]
Mouse Orthologue:
Kif13a
Mouse Description:
kinesin family member 13A Gene [Source:MGI Symbol;Acc:MGI:1098264]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12480 Splice Site, Nonsense Available for shipment Available now
sa9913 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101404 Splice Site, Nonsense 1024 1932 24 40
Genomic Location:
Chromosome 16 (position 56939615)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGCACAACACTAAAGACTCCAGCACTGGAGGAGTGTTTCAGCTGCGC[C/T]AGGTACCACACACACTCCTGCTACACACAGACTCACGGATGAGAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101404 Nonsense 1390 1932 35 40
Genomic Location:
Chromosome 16 (position 56969569)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTTACTTTAACATGCTCATATATGTTTTTCTAGAGCTCTAGTTG[T/A]AAATCAGACGGCCGGACGGGTTGTGAGGWTGAAGATGTGAAGGTCAGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/frrtexwd