KIF13A

Ensembl ID:
ENSDARG00000069594
Description:
kinesin family member 13A [Source:HGNC Symbol;Acc:14566]
Human Orthologue:
KIF13A
Human Description:
kinesin family member 13A [Source:HGNC Symbol;Acc:14566]
Mouse Orthologue:
Kif13a
Mouse Description:
kinesin family member 13A Gene [Source:MGI Symbol;Acc:MGI:1098264]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12480 Splice Site, Nonsense Available for shipment Available now
sa9913 Nonsense Available for shipment Available now
sa28758 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa12480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101404 Splice Site, Nonsense 1024 1932 24 40
Genomic Location:
Chromosome 16 (position 56939615)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGCACAACACTAAAGACTCCAGCACTGGAGGAGTGTTTCAGCTGCGC[C/T]AGGTACCACACACACTCCTGCTACACACAGACTCACGGATGAGAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101404 Nonsense 1390 1932 35 40
Genomic Location:
Chromosome 16 (position 56969569)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTTACTTTAACATGCTCATATATGTTTTTCTAGAGCTCTAGTTG[T/A]AAATCAGACGGCCGGACGGGTTGTGAGGWTGAAGATGTGAAGGTCAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101404 Nonsense 1715 1932 39 40
Genomic Location:
Chromosome 16 (position 56980804)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGTGCAGATGATGGTGTAGAAGAGGATGCTCTAGGTCATTTTGGCTGT[A/T]AGGCAGAATCAGCTTCTCAAGATAAAACGCAAAACAAGAGTTCTCCTTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/frrtexwd