si:dkey-100n23.2

Ensembl ID:
ENSDARG00000069593
ZFIN ID:
ZDB-GENE-070912-344
Mouse Orthologues:
Tlr11, Tlr12
Mouse Descriptions:
toll-like receptor 11 Gene [Source:MGI Symbol;Acc:MGI:3045226]
toll-like receptor 12 Gene [Source:MGI Symbol;Acc:MGI:3045221]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21506 Nonsense Available for shipment Available now
sa21507 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101409 Nonsense 139 737 3 7
ENSDART00000139920   None 175 None 1
Genomic Location (Zv9):
Chromosome 9 (position 31238293)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30394239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTTATTCAGCAACCTCACCAGTATTAAAATATTTCTGCATATGTTC[A/T]GATCAGATGATTTCCAATCTCTTTGTGCTTCAAAACCACATGCAGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101409 Essential Splice Site 393 737 6 7
ENSDART00000139920   None 175 None 1
Genomic Location (Zv9):
Chromosome 9 (position 31245732)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30401678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCCTGAGACCAATGCATCTTGTGATCGGGAGTAATACTACACTGAAT[A/G]ATGGGCTAAACTTACAGATTAAAGGTCAATATGTGATCGTTGAGGACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link