si:ch211-11o22.2

Ensembl ID:
ENSDARG00000069560
ZFIN ID:
ZDB-GENE-070912-23
Description:
Novel protein similar to vertebrate potassium voltage-gated channel, subfamily H (Eag-related) famil
Human Orthologue:
KCNH3
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 3 [Source:HGNC Symbol;Acc:6252]
Mouse Orthologue:
Kcnh3
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 3 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41434 Nonsense Mutation detected in F1 DNA During 2017
sa21499 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41434
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090625 Nonsense 521 874 12 18
ENSDART00000146284 Nonsense 577 914 9 15
Genomic Location (Zv9):
Chromosome 9 (position 28976514)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28132210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTTCATCCGTGTGCATCGACTGCCCAAAGCCCTTGCGCAGCGCATGT[T/A]GGAGTGCTTTCAGACCACATGGTCCGTCAACAATGGCATTGATGTCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090625 Essential Splice Site 621 874 13 18
ENSDART00000146284 Essential Splice Site 677 914 10 15
Genomic Location (Zv9):
Chromosome 9 (position 28974093)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28129789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGGGCTCCATGGAAGTGCTCAAGGACAACACTGTGCTGGCTATACTGG[G/A]TAAGATCATACTCACCATGCCTAATATCCGATAGCCAGAAAGTGATTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link