si:ch211-239f4.7

Ensembl ID:
ENSDARG00000069559
ZFIN ID:
ZDB-GENE-061207-26
Description:
Novel protein containing a SEA domain [Source:UniProtKB/TrEMBL;Acc:A2AW98]
Human Orthologues:
MUC12, MUC16, MUC17, MUC20, MUC4, MUC5B
Human Descriptions:
mucin 12, cell surface associated [Source:HGNC Symbol;Acc:7510]
mucin 16, cell surface associated [Source:HGNC Symbol;Acc:15582]
mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
mucin 20, cell surface associated [Source:HGNC Symbol;Acc:23282]
mucin 4, cell surface associated [Source:HGNC Symbol;Acc:7514]
mucin 5B, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7516]
Mouse Orthologues:
Muc20, Muc4
Mouse Descriptions:
mucin 20 Gene [Source:MGI Symbol;Acc:MGI:2385039]
mucin 4 Gene [Source:MGI Symbol;Acc:MGI:2153525]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16699 Essential Splice Site Available for shipment Available now
sa16487 Nonsense Available for shipment Available now
sa31228 Nonsense Available for shipment Available now
sa31229 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101347 Essential Splice Site 67 2492 4 11
ENSDART00000142702   None 200 None 5
Genomic Location (Zv9):
Chromosome 1 (position 45577117)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44420336
KASP Assay ID:
2259-0951.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGGAATRCTGGCCTGTGGCCAATCGTACAAAAACTAAAATTTTTAGG[T/G]AAGTGAGGGAATATTGTTTTCATTCTAAGAGGTTTCCAAAATAKAAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101347 Nonsense 157 2492 6 11
ENSDART00000142702   None 200 None 5
Genomic Location (Zv9):
Chromosome 1 (position 45579424)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44422643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTTCAACAGAGYCCCTAACAACCACCATTCAAGCACATTCAAGCAAA[C/T]AGAAGACTCCAGATGTAGGAACAGAAACCACAACTGATTYACAAACTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101347 Nonsense 870 2492 7 11
ENSDART00000142702   None 200 None 5
Genomic Location (Zv9):
Chromosome 1 (position 45582967)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44426186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAACATCCAGTAATACAAAGTCATCTACAGAAATCAATGCAGCTACAT[C/A]AGGAACAAGCACAGCATCAACTGTTAGAAATGATACACAAACAACCGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101347 Nonsense 1973 2492 7 11
ENSDART00000142702   None 200 None 5
Genomic Location (Zv9):
Chromosome 1 (position 45586277)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44429496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCTGAAACAGCTTCATTGACAAGTCAAACTACATTAACATCTCCATA[T/A]ACACCAAAATCAAGTACTTCTCCCAGCACAGCAGCACCAATAACAGAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link