atoh7

Ensembl ID:
ENSDARG00000069552
ZFIN ID:
ZDB-GENE-000926-1
Description:
Protein atonal homolog 7 [Source:UniProtKB/Swiss-Prot;Acc:Q8AW52]
Human Orthologue:
ATOH7
Human Description:
atonal homolog 7 (Drosophila) [Source:HGNC Symbol;Acc:13907]
Mouse Orthologue:
Atoh7
Mouse Description:
atonal homolog 7 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1355553]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16352 Nonsense Available for shipment Available now
sa35489 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16352
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101328 Nonsense 53 134 1 1
Genomic Location (Zv9):
Chromosome 13 (position 25673802)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25319462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAMGAAAGAGAATGCAAGGCCTGAACACGGCATTCGACCGGCTTCGS[A/T]AAGTGGTTCCACAGTGGGGTCAAGACAAGAAGCTGTCCAAATACGAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101328 Nonsense 97 134 1 1
Genomic Location (Zv9):
Chromosome 13 (position 25673936)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25319596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCGGATCCTGAGCGACGCTGGTAGACACGTGGATCCTCAGAAAGACTG[G/A]CTTAATTTACAGTTCGACGGCCTACAGACTGAGGGATATTTTATGCACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link