gtf3c4

Ensembl ID:
ENSDARG00000069538
ZFIN ID:
ZDB-GENE-041008-147
Description:
Novel protein similar to human general transcription factor IIIC, polypeptide 4, 90kDa (GTF3C4) [Sou
Human Orthologue:
GTF3C4
Human Description:
general transcription factor IIIC, polypeptide 4, 90kDa [Source:HGNC Symbol;Acc:4667]
Mouse Orthologue:
Gtf3c4
Mouse Description:
general transcription factor IIIC, polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:2138937]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43614 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43614
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101295 Nonsense 78 699 2 5
Genomic Location (Zv9):
Chromosome 21 (position 15932599)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 17384378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATCAATCCTCAATGTGGACCTCTCCATGGCGTCAAGTACACTAGTTG[G/A]TCACCGTTAGGCTGTGACAAACTCGGCCGCTGCCTTCTTGCTTTCCTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link