LOC100150862

Ensembl ID:
ENSDARG00000069522
Human Orthologue:
ROBO3
Human Description:
roundabout, axon guidance receptor, homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:13433]
Mouse Orthologue:
Robo3
Mouse Description:
roundabout homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1343102]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10843 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10843
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101240 Essential Splice Site 925 1054 20 23
Genomic Location:
Chromosome 15 (position 18632669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGACATGGCTGAAATGGAGGAACTCTTCTCCGGCAGCACAGCCACTAG[T/A]AAACCMTTCGCCGCTGCAAAAATAACTGCTTTTATTACACTCCCGATGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z0e13va7