bbs10

Ensembl ID:
ENSDARG00000069515
ZFIN ID:
ZDB-GENE-060503-355
Description:
Bardet-Biedl syndrome 10 [Source:RefSeq peptide;Acc:NP_001082932]
Human Orthologue:
BBS10
Human Description:
Bardet-Biedl syndrome 10 [Source:HGNC Symbol;Acc:26291]
Mouse Orthologue:
Bbs10
Mouse Description:
Bardet-Biedl syndrome 10 (human) Gene [Source:MGI Symbol;Acc:MGI:1919019]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28976 Nonsense Mutation detected in F1 DNA During 2017
sa39189 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28976
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101238 Nonsense 2 565 3 4
ENSDART00000122549 Nonsense 4 567 2 3
ENSDART00000141069   None 151 None 2
Genomic Location (Zv9):
Chromosome 18 (position 6843045)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7420735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTATATATATATATTTGTGTGTGTGTGTGTGTTTATGTGTGTAGATG[C/T]AGCAGCAGCTGGAATGTGTGTCTCTGCAGGTGTGTGTGAGTGTTCTCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101238 Nonsense 251 565 4 4
ENSDART00000122549 Nonsense 253 567 3 3
ENSDART00000141069   None 151 None 2
Genomic Location (Zv9):
Chromosome 18 (position 6840537)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7418227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTGAATTGCGAGGTCCAATAAAAGCGCTAGTTTTATATGAGAGTTTT[G/T]GATCATCTCTTGGTGATAATATAACCGTATGCTTTCAGCAAGACTGGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link