LOC100001799

Ensembl ID:
ENSDARG00000069504
Human Orthologue:
IL12B
Human Description:
interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2,
Mouse Orthologue:
Il12b
Mouse Description:
interleukin 12b Gene [Source:MGI Symbol;Acc:MGI:96540]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43037 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101216 Essential Splice Site 200 298 5 6
Genomic Location (Zv9):
Chromosome 18 (position 6173491)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7128592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTGCCTCACGTCATCACTGACTGAATGTTATTTGTCGTTTTTTCCTA[G/A]TTAAGCCAGCCAATCCAAACATTTCCATCTGCAGAGTAAAGGATGAGGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ankylosing spondylitis: Interaction between ERAP1 and HLA-B27 in ankylosing spondylitis implicates peptide handling in the mechanism for HLA-B27 in disease susceptibility. (View Study)
  • Crohn's disease: Fucosyltransferase 2 (FUT2) non-secretor status is associated with Crohn's disease. (View Study)
  • Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Crohn's disease: Sequence variants in the autophagy gene IRGM and multiple other replicating loci contribute to Crohn's disease susceptibility. (View Study)
  • Multiple sclerosis: Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. (View Study)
  • Multiple sclerosis: Genome-wide meta-analysis identifies novel multiple sclerosis susceptibility loci. (View Study)
  • Psoriasis: A genome-wide association study identifies new psoriasis susceptibility loci and an interaction between HLA-C and ERAP1. (View Study)
  • Psoriasis: Genome-wide association study identifies a psoriasis susceptibility locus at TRAF3IP2. (View Study)
  • Psoriasis: Genome-wide scan reveals association of psoriasis with IL-23 and NF-kappaB pathways. (View Study)
  • Psoriasis: Psoriasis genome-wide association study identifies susceptibility variants within LCE gene cluster at 1q21. (View Study)
  • Psoriatic arthritis: Common variants at TRAF3IP2 are associated with susceptibility to psoriatic arthritis and psoriasis. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link