cldnh

Ensembl ID:
ENSDARG00000069503
ZFIN ID:
ZDB-GENE-010328-8
Description:
claudin-3 [Source:RefSeq peptide;Acc:NP_571842]
Human Orthologue:
CLDN3
Human Description:
claudin 3 [Source:HGNC Symbol;Acc:2045]
Mouse Orthologue:
Cldn3
Mouse Description:
claudin 3 Gene [Source:MGI Symbol;Acc:MGI:1329044]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6673 Nonsense Mutation detected in F1 DNA During 2016
sa43654 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101211 Nonsense 103 214 2 2
Genomic Location (Zv9):
Chromosome 21 (position 25120842)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25704179
KASP Assay ID:
554-5174.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATCTTGGCTGTTCTAGGTGTGATGATCTCCGTCATGGGCGCCAAATG[C/A]ACCAATTGTATTGAGGATGAAGGTGCTAAGGCTAAAGTGATGATCGTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101211 Nonsense 137 214 2 2
Genomic Location (Zv9):
Chromosome 21 (position 25120740)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25704077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCATCATGTTCATTATTGCTGGCATCCTGGATCTCATTCCTTCAGCCTG[G/A]GTGGCAAACCAGATCATTCGGGACTTTTACAACCCGTTACTGCCCGGCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link