cldnh

Ensembl ID:
ENSDARG00000069503
ZFIN ID:
ZDB-GENE-010328-8
Description:
claudin-3 [Source:RefSeq peptide;Acc:NP_571842]
Human Orthologue:
CLDN3
Human Description:
claudin 3 [Source:HGNC Symbol;Acc:2045]
Mouse Orthologue:
Cldn3
Mouse Description:
claudin 3 Gene [Source:MGI Symbol;Acc:MGI:1329044]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6673 Nonsense Mutation detected in F1 DNA During 2014
sa4167 Nonsense Mutation detected in F1 DNA During 2014
sa19262 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101211 Nonsense 103 214 2 2
Genomic Location:
Chromosome 21 (position 25120842)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATCTTGGCTGTTCTAGGTGTGATGATCTCCGTCATGGGCGCCAAATG[C/A]ACCAATTGTATTGAGGATGAAGGTGCTAAGGCTAAAGTGATGATCGTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101211 Nonsense 208 214 2 2
ENSDART00000101211 Nonsense 208 214 2 2
Genomic Location:
Chromosome 21 (position 25120527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCCGGCAAGAATGGGCTATTCTGCTCCACGCTCAGCCAGCGCTGGATA[T/A]GACAAGAAGGACTATGTTTAAATCTGTAGAAGAAGAAAAAAAAAACAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101211 Nonsense 208 214 2 2
ENSDART00000101211 Nonsense 208 214 2 2
Genomic Location:
Chromosome 21 (position 25120527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCGGCAAGAATGGGCTATTCTGCTCCACGCTCAGCCAGCGCTGGATA[T/A]GACAAGAAGGACTATGTTTAAATCTGTAGAAGAAGAAAAAAAAAACAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q44n2kmj