hs6st3

Ensembl ID:
ENSDARG00000069500
ZFIN ID:
ZDB-GENE-070103-3
Description:
Heparan-sulfate 6-O-sulfotransferase 3 [Source:UniProtKB/Swiss-Prot;Acc:A0MGZ7]
Human Orthologue:
HS6ST3
Human Description:
heparan sulfate 6-O-sulfotransferase 3 [Source:HGNC Symbol;Acc:19134]
Mouse Orthologue:
Hs6st3
Mouse Description:
heparan sulfate 6-O-sulfotransferase 3 Gene [Source:MGI Symbol;Acc:MGI:1354960]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7632 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065929 Missense 205 419 2 2
Genomic Location (Zv9):
Chromosome 9 (position 30372939)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29528885
KASP Assay ID:
554-4359.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTGCGAGACCCAGTGTCCCGCTACCWGAGCGAATGGAAGCACGTGCA[G/T]CGCGGAGCCACCTGGAAGACCTCGCTCCACATGTGCGACGGCCGTTCGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link