phkg1b

Ensembl ID:
ENSDARG00000069498
ZFIN ID:
ZDB-GENE-050522-52
Description:
Zgc:110610 protein [Source:UniProtKB/TrEMBL;Acc:Q503G9]
Human Orthologue:
PHKG1
Human Description:
phosphorylase kinase, gamma 1 (muscle) [Source:HGNC Symbol;Acc:8930]
Mouse Orthologue:
Phkg1
Mouse Description:
phosphorylase kinase gamma 1 Gene [Source:MGI Symbol;Acc:MGI:97579]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43652 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43651 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101205 Essential Splice Site 28 394 2 10
ENSDART00000129619 Essential Splice Site 28 44 2 3
Genomic Location (Zv9):
Chromosome 21 (position 25065386)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25648723
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGGACAAGAATTTTATGACAAATATGATCCAAAGGAGATCTTGGGAAG[G/T]TTAGTGTCACCCTGATGAATTTGTGTCTGCAATCTATGACAAAATTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101205 Essential Splice Site 88 394 4 10
ENSDART00000129619   None 44 None 3
Genomic Location (Zv9):
Chromosome 21 (position 25064909)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25648246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTTTTTGTAACAACATACAAATGTAGGTTTTGTTTGTCCCTGGTA[G/T]TTCAACTCAAGGATTGCTTTGAATCAAAGGCCTTCTTCTTTTTGGTATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link