si:dkey-17e16.16

Ensembl ID:
ENSDARG00000069495
ZFIN ID:
ZDB-GENE-091204-145
Human Orthologue:
TMEM179B
Human Description:
transmembrane protein 179B [Source:HGNC Symbol;Acc:33744]
Mouse Orthologue:
Tmem179b
Mouse Description:
transmembrane protein 179B Gene [Source:MGI Symbol;Acc:MGI:1914956]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23945 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23945
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101202 Essential Splice Site 172 222 None 5
ENSDART00000148236 Essential Splice Site 172 222 None 6
Genomic Location (Zv9):
Chromosome 21 (position 25044608)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25627945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTTTTGATTTGTTTTTAATACAGTGTAAATTCTGTTCTCTCCTCCAC[A/T]GAGGTCTATGTGGGTCAGCTTCTTCTTCTGGATATTAATAACGGCCGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link