frem1a

Ensembl ID:
ENSDARG00000069473
ZFIN ID:
ZDB-GENE-081119-1
Description:
Fras1 related extracellular matrix 1a [Source:RefSeq peptide;Acc:NP_001177237]
Human Orthologue:
FREM1
Human Description:
FRAS1 related extracellular matrix 1 [Source:HGNC Symbol;Acc:23399]
Mouse Orthologue:
Frem1
Mouse Description:
Fras1 related extracellular matrix protein 1 Gene [Source:MGI Symbol;Acc:MGI:2670972]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27100 Nonsense Mutation detected in F1 DNA During 2016
sa1148 Essential Splice Site Available for shipment Available now
sa34238 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13110 Essential Splice Site Available for shipment Available now
sa31619 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41083 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9531 Nonsense Available for shipment Available now
sa41084 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa27100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Nonsense 218 1684 5 37
Genomic Location (Zv9):
Chromosome 7 (position 72394154)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69438889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTAAAATCCCCCCCCCCCTCCCCCTCCCCCATGCAGATAATAAAGCC[A/T]GAGCTCACTGTAAGACTGATGACTGCCTGAAGGGTCTCAAACTGCTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 387 1684 6 37
Genomic Location (Zv9):
Chromosome 7 (position 72395866)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69440601
KASP Assay ID:
554-1059.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTTCCAGCCTCCCAACTCCAGCGCCACACATCGCAGGAACTACGAGG[T/C]GAAACACGAATGCTTTAACATACTGTTTGTTTTTTTTATTGTATTTTTTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa34238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 782 1684 13 37
Genomic Location (Zv9):
Chromosome 7 (position 72407549)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69452284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCTGCTTTAACGTAACTGTTCTGCCAGTGGATAACCAGGCACCAGAG[G/T]TACAAGAACCCTTAATTACAAGAGTTAAAAAGTACTCACCCACACTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13110
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 1093 1684 19 37
Genomic Location (Zv9):
Chromosome 7 (position 72416387)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69461122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTGATGTATATTGAATCCTGATATCCTAATGWTGYTGTTCCTCGTTC[A/G]GCCTCGTTCACCTAYAGGGRTGTGTTGGATGGACACATTAACTATGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 1158 1684 19 37
Genomic Location (Zv9):
Chromosome 7 (position 72416587)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69461322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCCAACTAATGACGAGATTCCAGACTTCCAGACTCAAAACATCACGG[T/A]GGGTCACAGGGACATTCGGTAACTCTCAGCTAACTGAGAATATTATTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 1229 1684 20 37
Genomic Location (Zv9):
Chromosome 7 (position 72418604)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69463339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGAGGAGCCTGTCCAGCATTTTTGCATGGATGACCTCAAGAGCGGCAA[G/A]TCTCAAATTTAAACATAAATATAAGCTTGCCAACTTTTTTTTTTTGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Nonsense 1234 1684 21 37
Genomic Location (Zv9):
Chromosome 7 (position 72418787)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69463522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YATACTTAAGTTTATAATGTGTCTCTGTCCACAGGCATGACTCTGATGTA[T/A]GTACACGATGACTCTGAGAGTGAGCAGGATGAATTCATCCTTCAGCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site None 1684 29 37
Genomic Location (Zv9):
Chromosome 7 (position 72431335)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69476070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGGAAAGACTTTATACCAGCTTCATCTCTGATTCAGTTTGACCCAGG[T/C]AAACAAAAATATGCTGAATATTGCATGATAGTGGGTGACATTGCGGAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link