frem1a

Ensembl ID:
ENSDARG00000069473
ZFIN ID:
ZDB-GENE-081119-1
Description:
Fras1 related extracellular matrix 1a [Source:RefSeq peptide;Acc:NP_001177237]
Human Orthologue:
FREM1
Human Description:
FRAS1 related extracellular matrix 1 [Source:HGNC Symbol;Acc:23399]
Mouse Orthologue:
Frem1
Mouse Description:
Fras1 related extracellular matrix protein 1 Gene [Source:MGI Symbol;Acc:MGI:2670972]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1148 Essential Splice Site Available for shipment Available now
sa13110 Essential Splice Site Available for shipment Available now
sa9531 Nonsense Available for shipment Available now
sa18899 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 387 1684 6 37
Genomic Location:
Chromosome 7 (position 72395866)
KASP Assay ID:
554-1059.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTTCCAGCCTCCCAACTCCAGCGCCACACATCGCAGGAACTACGAGG[T/C]GAAACACGAATGCTTTAACATACTGTTTGTTTTTTTTATTGTATTTTTTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13110
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 1093 1684 19 37
Genomic Location:
Chromosome 7 (position 72416387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTGATGTATATTGAATCCTGATATCCTAATGWTGYTGTTCCTCGTTC[A/G]GCCTCGTTCACCTAYAGGGRTGTGTTGGATGGACACATTAACTATGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Nonsense 1234 1684 21 37
Genomic Location:
Chromosome 7 (position 72418787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YATACTTAAGTTTATAATGTGTCTCTGTCCACAGGCATGACTCTGATGTA[T/A]GTACACGATGACTCTGAGAGTGAGCAGGATGAATTCATCCTTCAGCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 1277 1684 21 37
Genomic Location:
Chromosome 7 (position 72418917)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGGTGAAAATACTGCCTGTCAACGACGAGGAGCCGCAAATCATCCGG[T/G]AACTGCAGATGAATATCAGTAAAATAAATCATGCTGTGTTTTTATCCGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fws10v24