khdrbs2

Ensembl ID:
ENSDARG00000069469
ZFIN ID:
ZDB-GENE-061013-497
Description:
KH domain-containing, RNA-binding, signal transduction-associated protein 2 [Source:UniProtKB/Swiss-
Human Orthologue:
KHDRBS2
Human Description:
KH domain containing, RNA binding, signal transduction associated 2 [Source:HGNC Symbol;Acc:18114]
Mouse Orthologue:
Khdrbs2
Mouse Description:
KH domain containing, RNA binding, signal transduction associated 2 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6297 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101134 Essential Splice Site 296 346 7 9
Genomic Location (Zv9):
Chromosome 13 (position 23606343)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23252003
KASP Assay ID:
554-4505.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCAGAGTTATGAGAGCTATGATGACAACTACAGCAACCAGTCGAAAAG[G/A]TCYACATCTATTTTTTAAGGGCCTCTATTGTGAGCTAATTAATGCTTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link