igsf9bb

Ensembl ID:
ENSDARG00000069467
ZFIN ID:
ZDB-GENE-091112-15
Human Orthologue:
IGSF9B
Human Description:
immunoglobulin superfamily, member 9B [Source:HGNC Symbol;Acc:32326]
Mouse Orthologue:
Igsf9b
Mouse Description:
immunoglobulin superfamily, member 9B Gene [Source:MGI Symbol;Acc:MGI:2685354]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37311 Nonsense Available for shipment Available now
sa37310 Nonsense Mutation detected in F1 DNA During 2017
sa32349 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101136 Nonsense 434 1339 10 19
ENSDART00000142907 Nonsense 434 1325 10 18
Genomic Location (Zv9):
Chromosome 21 (position 24019911)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 24705585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCAAATTTTTGGTGGTTCCTGGAGGGGAGTACAGGCAGGAGGCTGGT[C/T]GAGAGCTGGTCATCCCCTGCGAGGCAGAAGGAGACCCATTCCCCAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101136 Nonsense 1132 1339 18 19
ENSDART00000142907 Nonsense 1132 1325 18 18
Genomic Location (Zv9):
Chromosome 21 (position 23981493)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 24667167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCAAGCCTCAGGGCCTTCCAGCCAAGCGTTTACCTATGCAAGAGGCA[C/T]AGAGTCTAGGGCAGCTAAGACACACAAGCCACGGTATGGGTGTACCGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101136 Nonsense 1271 1339 18 19
ENSDART00000142907 Nonsense 1271 1325 18 18
Genomic Location (Zv9):
Chromosome 21 (position 23981076)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 24666750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTTCTCCTGCTCAAGGCCAAGGCAGCCGAAGGGCAAGTCCCAGCTAC[C/T]GATCCCACATGGCATTTGCCACCTCAGCGGCAAGCTATCCGTCACAGTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link