cx50.5

Ensembl ID:
ENSDARG00000069451
ZFIN ID:
ZDB-GENE-050616-14
Description:
44.1 protein-like [Source:RefSeq peptide;Acc:NP_001121822]
Human Orthologue:
GJA8
Human Description:
gap junction protein, alpha 8, 50kDa [Source:HGNC Symbol;Acc:4281]
Mouse Orthologue:
Gja8
Mouse Description:
gap junction protein, alpha 8 Gene [Source:MGI Symbol;Acc:MGI:99953]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu7915 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu7915
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101106 None None 380 None 2
ENSDART00000138364 Nonsense 683 709 1 1
Genomic Location:
Chromosome 9 (position 31463578)
KASP Assay ID:
554-2399.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGGAGGCTYTAGAGGAGATGATAGATGCTCCAYTTGTAGCTCTAGATT[T/A]AGAACCAACAGAGGAAACAAGATCTTCAAGTCGTCTCAGCAAAGGTAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lmdydzy6