cx41.8

Ensembl ID:
ENSDARG00000069450
ZFIN ID:
ZDB-GENE-050616-11
Description:
connexin 41.8 [Source:RefSeq peptide;Acc:NP_001030160]
Human Orthologue:
GJA5
Human Description:
gap junction protein, alpha 5, 40kDa [Source:HGNC Symbol;Acc:4279]
Mouse Orthologue:
Gja5
Mouse Description:
gap junction protein, alpha 5 Gene [Source:MGI Symbol;Acc:MGI:95716]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19566 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19565 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101104 Essential Splice Site None 370 1 2
Genomic Location:
Chromosome 1 (position 47927882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGATCTCAAACAGACACGTGCTGCTACGCTAACTGGTTTCAATCAG[G/A]TATGTAGAAAGTGTCACACACACAAAAACATAGATTTGTCCCAATATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101104 Nonsense 170 370 2 2
Genomic Location:
Chromosome 1 (position 47913438)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCGCACTGTGATGGAAGTGATCTTCATCATAATCCAGTACCTGATCTA[C/A]GGAGTCTTCCTTAGTGCACTCTATGTGTGTAAAGCCCCTCCGTGTCCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ccoydiq0