dbh

Ensembl ID:
ENSDARG00000069446
ZFIN ID:
ZDB-GENE-990621-3
Description:
dopamine beta-hydroxylase [Source:RefSeq peptide;Acc:NP_001103164]
Human Orthologue:
DBH
Human Description:
dopamine beta-hydroxylase (dopamine beta-monooxygenase) [Source:HGNC Symbol;Acc:2689]
Mouse Orthologue:
Dbh
Mouse Description:
dopamine beta hydroxylase Gene [Source:MGI Symbol;Acc:MGI:94864]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21676 Essential Splice Site Available for shipment Available now
sa24865 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101089 Essential Splice Site 244 614 None 12
ENSDART00000123564 Essential Splice Site None 192 None 11

The following transcripts of ENSDARG00000069446 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 10565416)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10641282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATATCTATCAGCTCCCGCCAAATCTGCCCAAGAACCACATTGTCATGG[T/C]AACTTGAGAGCCACTCGCACATTACAAATAACCTTTCTATGTGAACTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101089 Essential Splice Site 517 614 10 12
ENSDART00000123564   None 192 None 11

The following transcripts of ENSDARG00000069446 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 10539265)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10615131
KASP Assay ID:
554-7864.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCACGTGGACACAGATTACCTGCAGAAATACTTCAGCCTCATCAACAG[G/A]TACAAAACACACACAACAACTACAGCAAACACAACCTTCCCCCGGTGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link