LOC100329778

Ensembl ID:
ENSDARG00000069442
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3930 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101083 Nonsense 120 188 2 2
ENSDART00000130772 Nonsense 117 196 2 2
Genomic Location:
Chromosome 15 (position 19859227)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCATCCCAGTGGACTCGTTCGGTAAGAGGGACGGACGTGCTGTAGAG[A/T]AACATGTGGGGGTTCTCGGGGATGTGGTGTGGTCCCGCACTCTGGTGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9ff526vf