tnk2b

Ensembl ID:
ENSDARG00000069433
ZFIN ID:
ZDB-GENE-030131-7427
Description:
tyrosine kinase, non-receptor, 2b [Source:RefSeq peptide;Acc:NP_001073486]
Human Orthologue:
TNK1
Human Description:
tyrosine kinase, non-receptor, 1 [Source:HGNC Symbol;Acc:11940]
Mouse Orthologue:
Tnk1
Mouse Description:
tyrosine kinase, non-receptor, 1 Gene [Source:MGI Symbol;Acc:MGI:1930958]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44662 Nonsense Mutation detected in F1 DNA During 2017
sa40895 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20947 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089856 Nonsense 356 732 8 14
ENSDART00000135313 Nonsense 357 733 8 14
ENSDART00000140528   None 123 None 4
ENSDART00000141353   None 183 None 4

The following transcripts of ENSDARG00000069433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 27681500)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGTTGTATGCTGTGATGCGCAAATGTTGGGCCTGCAATTCTACTGAA[C/T]GACCGACCTTCGCACAGCTCACCACCATGGTATCAGAGGTCAGTGTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089856 Essential Splice Site 400 732 9 14
ENSDART00000135313 Essential Splice Site 401 733 9 14
ENSDART00000140528   None 123 None 4
ENSDART00000141353   None 183 None 4

The following transcripts of ENSDARG00000069433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 27682453)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26285392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGACTCTCTCTACAGGCAAATGATCTAGTGACTGTAATAGACCATGGG[T/G]AAGAGTGGGGGTGGAAGGCTGGAAGGATAAAACAAAAAAAATCATGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089856 Nonsense 409 732 10 14
ENSDART00000135313 Nonsense 410 733 10 14
ENSDART00000140528   None 123 None 4
ENSDART00000141353   None 183 None 4

The following transcripts of ENSDARG00000069433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 27683493)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26286432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACTTGGCTGTGCTTTTATGTAGGTTGGATATGTGCGAGTGGAAGGGA[C/T]AGAACCAGAGGACTCTGAGTGTTGGCTGGTTTCCCCCTGCGTTAACAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link