tnk2b

Ensembl ID:
ENSDARG00000069433
ZFIN ID:
ZDB-GENE-030131-7427
Description:
tyrosine kinase, non-receptor, 2b [Source:RefSeq peptide;Acc:NP_001073486]
Human Orthologue:
TNK1
Human Description:
tyrosine kinase, non-receptor, 1 [Source:HGNC Symbol;Acc:11940]
Mouse Orthologue:
Tnk1
Mouse Description:
tyrosine kinase, non-receptor, 1 Gene [Source:MGI Symbol;Acc:MGI:1930958]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20947 Nonsense Mutation detected in F1 DNA During 2015
sa2401 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa20947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089856 Nonsense 409 732 10 14
ENSDART00000135313 Nonsense 410 733 10 14
ENSDART00000140528   None 123 None 4
ENSDART00000141353   None 183 None 4

The following transcripts of ENSDARG00000069433 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 27683493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACTTGGCTGTGCTTTTATGTAGGTTGGATATGTGCGAGTGGAAGGGA[C/T]AGAACCAGAGGACTCTGAGTGTTGGCTGGTTTCCCCCTGCGTTAACAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089856 Nonsense 690 732 14 14
ENSDART00000135313 Nonsense 691 733 14 14
ENSDART00000140528   None 123 None 4
ENSDART00000141353   None 183 None 4

The following transcripts of ENSDARG00000069433 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 27690116)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAAGATTTTCCTGATATCTTCAGACAGACCAGCTGTATTACATGAAT[C/T]AGTGCACTCGTGAGGAATGTCAGAAAGTCCTCTCACGCTACAACTGGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ccs0prq6