tnk2b

Ensembl ID:
ENSDARG00000069433
ZFIN ID:
ZDB-GENE-030131-7427
Description:
tyrosine kinase, non-receptor, 2b [Source:RefSeq peptide;Acc:NP_001073486]
Human Orthologue:
TNK1
Human Description:
tyrosine kinase, non-receptor, 1 [Source:HGNC Symbol;Acc:11940]
Mouse Orthologue:
Tnk1
Mouse Description:
tyrosine kinase, non-receptor, 1 Gene [Source:MGI Symbol;Acc:MGI:1930958]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20947 Nonsense Mutation detected in F1 DNA During 2014
sa2401 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089856 Nonsense 409 732 10 14
ENSDART00000135313 Nonsense 410 733 10 14
ENSDART00000140528 None None 123 None 4
ENSDART00000141353 None None 183 None 4

The following transcripts of ENSDARG00000069433 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 27683493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACTTGGCTGTGCTTTTATGTAGGTTGGATATGTGCGAGTGGAAGGGA[C/T]AGAACCAGAGGACTCTGAGTGTTGGCTGGTTTCCCCCTGCGTTAACAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089856 Nonsense 690 732 14 14
ENSDART00000135313 Nonsense 691 733 14 14
ENSDART00000140528 None None 123 None 4
ENSDART00000141353 None None 183 None 4

The following transcripts of ENSDARG00000069433 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 27690116)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAAGATTTTCCTGATATCTTCAGACAGACCAGCTGTATTACATGAAT[C/T]AGTGCACTCGTGAGGAATGTCAGAAAGTCCTCTCACGCTACAACTGGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ccs0prq6