nhp2

Ensembl ID:
ENSDARG00000069422
ZFIN ID:
ZDB-GENE-030131-533
Description:
H/ACA ribonucleoprotein complex subunit 2-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q6PBV6]
Human Orthologue:
NHP2
Human Description:
NHP2 ribonucleoprotein homolog (yeast) [Source:HGNC Symbol;Acc:14377]
Mouse Orthologue:
Nhp2
Mouse Description:
NHP2 ribonucleoprotein homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1098547]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37343 Nonsense Mutation detected in F1 DNA During 2017
sa39337 Nonsense Mutation detected in F1 DNA During 2017
sa1137 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa37343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101037 Nonsense 20 150 1 4

The following transcripts of ENSDARG00000069422 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29152633)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30371877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTAAAGAAGGAGAAAGCCGGGGAAGAGGAAACCGGAGGGACGGAAAAAT[C/A]ATATCAAGAGTTGATTGCTAATATTAACCCAATCGCAAACCCGCTAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101037 Nonsense 21 150 1 4

The following transcripts of ENSDARG00000069422 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29152629)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30371873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAGGAGAAAGCCGGGGAAGAGGAAACCGGAGGGACGGAAAAATCATA[T/A]CAAGAGTTGATTGCTAATATTAACCCAATCGCAAACCCGCTAGCATCGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1137
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101037 Nonsense 102 150 3 4

The following transcripts of ENSDARG00000069422 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 29146439)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30365683
KASP Assay ID:
554-1048.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGTCTACTGTCACCTACCAATCATGTGTGAAGACAGAAGCCTGCCGTA[T/A]GCTTATGTGCCGTCCAAAGTCGTAAGTTAATCAGAAGCGTATACAATAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link