si:dkey-206l1.5

Ensembl ID:
ENSDARG00000069419
ZFIN ID:
ZDB-GENE-050208-455
Description:
Novel protein similar to H.sapiens ACDY9, adenylate cyclase 9 (ACDY9) [Source:UniProtKB/TrEMBL;Acc:A
Human Orthologue:
ADCY9
Human Description:
adenylate cyclase 9 [Source:HGNC Symbol;Acc:240]
Mouse Orthologue:
Adcy9
Mouse Description:
adenylate cyclase 9 Gene [Source:MGI Symbol;Acc:MGI:108450]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37531 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa43863 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101030 Splice Site, Nonsense 600 1277 5 17
ENSDART00000135418   None 259 None 1
Genomic Location (Zv9):
Chromosome 22 (position 27294275)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTAAACCCAGCCATAACTGTAAAGTATTCCTAAAATCAGAGGAGAATT[T/A]AACTAGTTTTTTATTTACCAAGAGGCAACATAAAAAGCCAATACAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101030 Splice Site, Nonsense 605 1277 6 17
ENSDART00000135418   None 259 None 1
Genomic Location (Zv9):
Chromosome 22 (position 27295228)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26801044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAGATGTTAATCAGGGAACATGTCCTACTTGGCGAAATCAGGTTGGCA[T/A]ATTGACGACACACGCAAAAGTGCAACAGTCTAACTTGCAACTAGAGGTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link