col17a1a

Ensembl ID:
ENSDARG00000069415
ZFIN ID:
ZDB-GENE-090313-107
Description:
collagen, type XVII, alpha 1a [Source:RefSeq peptide;Acc:NP_001139037]
Human Orthologue:
COL17A1
Human Description:
collagen, type XVII, alpha 1 [Source:HGNC Symbol;Acc:2194]
Mouse Orthologue:
Col17a1
Mouse Description:
collagen, type XVII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88450]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7401 Missense Mutation detected in F1 DNA During 2014
sa19578 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16045 Essential Splice Site Available for shipment Available now
sa19579 Nonsense Mutation detected in F1 DNA During 2014
sa652 Nonsense F2 line generated During 2014
sa19580 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101004 Missense 128 1191 3 45
ENSDART00000142957 Missense 261 1408 7 52
Genomic Location:
Chromosome 1 (position 50087290)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGNNNTTTTTTTTTGTTTATTTGCAGTTTCCACTAGCAGTGCTGCCA[C/T]CAGAGGGCGCACTCAAACACGAGGTATTTATCATTTAAAACCTACTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101004 None None 1191 None 45
ENSDART00000142957 Essential Splice Site 403 1408 12 52
Genomic Location:
Chromosome 1 (position 50090488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTACATCTGGCGGTGCTATGATGGCTAATGGAAGGTGCACTGGCTATG[G/A]TAAACTCAATCTTATCTCACTTCAATACTGTGCTTATTTTAAATGTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101004 None None 1191 None 45
ENSDART00000142957 Essential Splice Site 404 1408 12 52
Genomic Location:
Chromosome 1 (position 50090489)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCYACATCTGGCGGTGCTATGATGGCTAATGGAAGGTGCACTGGCTATGG[T/A]AAACTCARTCTTATCTCACTTCAATACTNNNNGTGCTTATTTTAAATGTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101004 Nonsense 477 1191 14 45
ENSDART00000142957 Nonsense 582 1408 18 52
Genomic Location:
Chromosome 1 (position 50093947)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGCTGAAGGCTCGTGTGGATGCTATCGATGGTGGAGGAACCTCTCCT[C/T]GAACCAGCGGTTTGAAAACTGACGACATTCCTGGGGTCCAATCTGGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa652
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101004 None None 1191 None 45
ENSDART00000142957 Nonsense 630 1408 19 52
Genomic Location:
Chromosome 1 (position 50094685)
KASP Assay ID:
554-0560.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTTAACATTTATTTACAATTCAATATTTGTTATGATTTATTATAGCAT[C/A]GCTGGCAACTTCGCTCAGGGGAGAGAGAGGAGAACCTGGACCTAAAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19580
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101004 Essential Splice Site 669 1191 22 45
ENSDART00000142957 Essential Splice Site 782 1408 26 52
Genomic Location:
Chromosome 1 (position 50100753)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTTCTTTTAGGTGATAAAGGACCTGCTGGGCCACCTGGGGTCAAAG[G/A]TCTGTAGATATCAGAGAAACGCATTGACAAAACTACTGCAGTTTACATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a7kwuu5k