
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cx34.5
- Ensembl ID:
- ENSDARG00000069411
- ZFIN ID:
- ZDB-GENE-050224-2
- Description:
- connexin 34.5 [Source:RefSeq peptide;Acc:NP_001025371]
- Human Orthologues:
- GJA1, GJA3, GJA4, GJA5, GJA8
- Human Descriptions:
- gap junction protein, alpha 1, 43kDa [Source:HGNC Symbol;Acc:4274]
- gap junction protein, alpha 3, 46kDa [Source:HGNC Symbol;Acc:4277]
- gap junction protein, alpha 4, 37kDa [Source:HGNC Symbol;Acc:4278]
- gap junction protein, alpha 5, 40kDa [Source:HGNC Symbol;Acc:4279]
- gap junction protein, alpha 8, 50kDa [Source:HGNC Symbol;Acc:4281]
- Mouse Orthologues:
- Gja1, Gja3, Gja4, Gja5, Gja6, Gja8
- Mouse Descriptions:
- gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]
- gap junction protein, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:95714]
- gap junction protein, alpha 4 Gene [Source:MGI Symbol;Acc:MGI:95715]
- gap junction protein, alpha 5 Gene [Source:MGI Symbol;Acc:MGI:95716]
- gap junction protein, alpha 6 Gene [Source:MGI Symbol;Acc:MGI:95717]
- gap junction protein, alpha 8 Gene [Source:MGI Symbol;Acc:MGI:99953]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12968 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12968
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101007 | Nonsense | 286 | 298 | 2 | 2 |
ENSDART00000135305 | Nonsense | 286 | 298 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 20 (position 40789259)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 40860418 GRCz11 20 40757528 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGAGCTTCAGAGGAGGGAACCTGGCAATGAGGCGACCAAGAGCTTGGCTT[C/A]AGAGGGTCGCAGTGCTGACATGCAAGAGGTTCATATCTGATCAKCAGGCC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cognitive performance: Common genetic variation and performance on standardized cognitive tests. (View Study)
- Formal thought disorder in schizophrenia: PKNOX2 is associated with formal thought disorder in schizophrenia: a meta-analysis of two genome-wide association studies. (View Study)
- Protein quantitative trait loci: A genome-wide association study identifies protein quantitative trait loci (pQTLs). (View Study)
- Resting heart rate: Common genetic variation near the connexin-43 gene is associated with resting heart rate in African Americans: a genome-wide association study of 13,372 participants. (View Study)
- Resting heart rate: Genome-wide association analysis identifies multiple loci related to resting heart rate. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
More OMIM information for GJA5
- Atrioventricular septal defect 3
- Hallermann-Streiff syndrome
- Hypoplastic left heart syndrome 1
- Oculodentodigital dysplasia
- Oculodentodigital dysplasia, autosomal recessive
- Syndactyly, type III
More OMIM information for GJA1
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: