cx34.5

Ensembl ID:
ENSDARG00000069411
ZFIN ID:
ZDB-GENE-050224-2
Description:
connexin 34.5 [Source:RefSeq peptide;Acc:NP_001025371]
Human Orthologues:
GJA1, GJA3, GJA4, GJA5, GJA8
Human Descriptions:
gap junction protein, alpha 1, 43kDa [Source:HGNC Symbol;Acc:4274]
gap junction protein, alpha 3, 46kDa [Source:HGNC Symbol;Acc:4277]
gap junction protein, alpha 4, 37kDa [Source:HGNC Symbol;Acc:4278]
gap junction protein, alpha 5, 40kDa [Source:HGNC Symbol;Acc:4279]
gap junction protein, alpha 8, 50kDa [Source:HGNC Symbol;Acc:4281]
Mouse Orthologues:
Gja1, Gja3, Gja4, Gja5, Gja6, Gja8
Mouse Descriptions:
gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]
gap junction protein, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:95714]
gap junction protein, alpha 4 Gene [Source:MGI Symbol;Acc:MGI:95715]
gap junction protein, alpha 5 Gene [Source:MGI Symbol;Acc:MGI:95716]
gap junction protein, alpha 6 Gene [Source:MGI Symbol;Acc:MGI:95717]
gap junction protein, alpha 8 Gene [Source:MGI Symbol;Acc:MGI:99953]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12968 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101007 Nonsense 286 298 2 2
ENSDART00000135305 Nonsense 286 298 1 1
Genomic Location:
Chromosome 20 (position 40789259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCTTCAGAGGAGGGAACCTGGCAATGAGGCGACCAAGAGCTTGGCTT[C/A]AGAGGGTCGCAGTGCTGACATGCAAGAGGTTCATATCTGATCAKCAGGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nwq4z120