LOC100333727

Ensembl ID:
ENSDARG00000069408
Human Orthologue:
FUT7
Human Description:
fucosyltransferase 7 (alpha (1,3) fucosyltransferase) [Source:HGNC Symbol;Acc:4018]
Mouse Orthologue:
Fut7
Mouse Description:
fucosyltransferase 7 Gene [Source:MGI Symbol;Acc:MGI:107692]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa929 Nonsense F2 line generated During 2014
sa20415 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa929
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100999 Nonsense 176 349 1 1
Genomic Location:
Chromosome 5 (position 26911886)
KASP Assay ID:
554-0834.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTAACACTACATATGTCATTCCCAGTAAAAGTGACTGTCTGGTTTGTTG[G/A]GTGGTCAGTAAATACAAATCCAACCAGAGTCGCTCTCTAGTTTTCCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100999 Nonsense 201 349 1 1
Genomic Location:
Chromosome 5 (position 26911959)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGAGTCGCTCTCTAGTTTTCCATCAGCTGAAAAAGCACATTCCTTCC[A/T]GACGTATTGAAGTGTATGGTCAATGGACAAACCGGCCACTCTCAAACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ykkus7b3