lrrc4.1

Ensembl ID:
ENSDARG00000069402
ZFIN ID:
ZDB-GENE-041210-129
Description:
Si:ch211-235l7.2 [Source:UniProtKB/TrEMBL;Acc:A8BBB4]
Human Orthologue:
LRRC4
Human Description:
leucine rich repeat containing 4 [Source:HGNC Symbol;Acc:15586]
Mouse Orthologue:
Lrrc4
Mouse Description:
leucine rich repeat containing 4 Gene [Source:MGI Symbol;Acc:MGI:2182081]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17055 Nonsense Available for shipment Available now
sa17086 Nonsense Available for shipment Available now
hu3286 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
sa17055
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100971 Nonsense 52 666 1 2
ENSDART00000140028 Nonsense 56 858 2 2
Genomic Location:
Chromosome 4 (position 18470517)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGGCCCCAGGGTTGCCCGACTGATTGCTCCTGCAACAACCAGCTCAGC[A/T]AGGTGGTGTGCACCAGACRTGGGCTCACTCRTGTGCCMCCAGGCWTACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17086
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100971 Nonsense 129 666 1 2
ENSDART00000140028 Nonsense 133 858 2 2
Genomic Location:
Chromosome 4 (position 18470749)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTYAGTGGGTTAACCAATCTCAATACTCTGGAACTATTTGATAACAGAT[T/A]GACTGTGGTGCCWAGTGGGGCRTTTGAGTATCTGTCCAAGCTGAGAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3286
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100971 Nonsense 309 666 1 2
ENSDART00000140028 Nonsense 313 858 2 2
Genomic Location:
Chromosome 4 (position 18471290)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCACAACCCCTGGAACTGTGGCTGTGATTCACTTTGGTTAGCACGTTG[G/A]CTGCGAGAGTACATACCCACCAACTCAACATGCTGTGGGCGTTGCCATTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v8y05fi0