gtpbpl

Ensembl ID:
ENSDARG00000069386
ZFIN ID:
ZDB-GENE-031110-2
Description:
GTP binding protein like isoform 1 [Source:RefSeq peptide;Acc:NP_001002140]
Human Orthologues:
MTG1, RP11-108K14.8
Human Description:
mitochondrial GTPase 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:32159]
Mouse Orthologue:
Mtg1
Mouse Description:
mitochondrial GTPase 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2685015]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22276 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22276
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078567 Nonsense 29 248 4 11
ENSDART00000100931 Nonsense 29 248 5 12
ENSDART00000129653 Nonsense 29 238 3 10
ENSDART00000134950 Nonsense 29 248 4 11
ENSDART00000137804 Nonsense 29 138 4 8
Genomic Location (Zv9):
Chromosome 13 (position 21818221)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21547559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAAGCAGTTTGAGAGAGAGGGTGTGAAAAATGTTTTATTTACAGACTG[T/A]TTAAGACAACATGATGAGAATGTAAAAAAGGTGAGCGGCGTCAGACATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link