RGL3 (3 of 3)

Ensembl ID:
ENSDARG00000069385
Description:
ral guanine nucleotide dissociation stimulator-like 3 [Source:HGNC Symbol;Acc:30282]
Human Orthologue:
RGL3
Human Description:
ral guanine nucleotide dissociation stimulator-like 3 [Source:HGNC Symbol;Acc:30282]
Mouse Orthologue:
Rgl3
Mouse Description:
ral guanine nucleotide dissociation stimulator-like 3 Gene [Source:MGI Symbol;Acc:MGI:1918996]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38169 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098962   None 218 None 4
ENSDART00000100930 Essential Splice Site 6 285 1 8
Genomic Location (Zv9):
Chromosome Zv9_NA15 (position 975)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150602.1 975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACACTGCGGGCCAAGAAGAGCTCAGGAATCATGAAGCGGTGGAGCGA[G/A]TGAGTGAAACACACACACACACACACACACACACGATGATGTTTTATATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link