mxtx1

Ensembl ID:
ENSDARG00000069382
ZFIN ID:
ZDB-GENE-000710-7
Description:
mix-type homeobox gene 1 [Source:RefSeq peptide;Acc:NP_571635]
Human Orthologues:
AC025287.2, AL022345.1, AL592170.2, AL671532.1, AL671532.2, AL671532.3, CT476828.10, CT476828.11, CT476828.12, CT476828.13, CT476828.14, CT476828.2, CT476828.3, CT476828.4, CT476828.5, CT476828.6, CT476828.7, CT476828.8, CT476828.9, DUX4, DUX4L2, DUX4L3, DUX4L4, DUX4L5, DUX4L6, DUX4L7, DUXA
Human Descriptions:
D4S2463 homeobox-like [Source:UniProtKB/TrEMBL;Acc:Q13060]
D4S2463 homeobox-like [Source:UniProtKB/TrEMBL;Acc:Q13060]
D4S2463 homeobox-like [Source:UniProtKB/TrEMBL;Acc:Q13060]
D4S2463 homeobox-like [Source:UniProtKB/TrEMBL;Acc:Q13060]
D4S2463 homeobox-like [Source:UniProtKB/TrEMBL;Acc:Q13060]
D4S2463 homeobox-like [Source:UniProtKB/TrEMBL;Acc:Q13060]
D4S2463 homeobox-like [Source:UniProtKB/TrEMBL;Acc:Q13060]
D4S2463 homeobox-like [Source:UniProtKB/TrEMBL;Acc:Q13060]
D4S2463 homeobox-like [Source:UniProtKB/TrEMBL;Acc:Q13060]
D4S2463 homeobox-like [Source:UniProtKB/TrEMBL;Acc:Q13060]
D4S2463 homeobox-like [Source:UniProtKB/TrEMBL;Acc:Q13060]
D4S2463 homeobox-like [Source:UniProtKB/TrEMBL;Acc:Q13060]
double homeobox 4 like 2 [Source:HGNC Symbol;Acc:37267]
double homeobox 4 like 3 [Source:HGNC Symbol;Acc:38688]
double homeobox 4 like 4 [Source:HGNC Symbol;Acc:38686]
double homeobox 4 like 5 [Source:HGNC Symbol;Acc:38689]
double homeobox 4 like 6 [Source:HGNC Symbol;Acc:37265]
double homeobox 4 like 7 [Source:HGNC Symbol;Acc:37266]
double homeobox 4 [Source:HGNC Symbol;Acc:3082]
Double homeobox 4c [Source:UniProtKB/TrEMBL;Acc:Q6RFH8]
double homeobox A [Source:HGNC Symbol;Acc:32179]
Homeobox-like [Source:UniProtKB/TrEMBL;Acc:Q14547]
Mouse Orthologues:
Duxbl, Gm10391, Gm10394
Mouse Descriptions:
double homeobox B-like Gene [Source:MGI Symbol;Acc:MGI:1916048]
predicted gene 10391 Gene [Source:MGI Symbol;Acc:MGI:3710520]
predicted gene 10394 Gene [Source:MGI Symbol;Acc:MGI:3710620]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22275 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100922 Essential Splice Site 8 295 2 4
ENSDART00000100925 Essential Splice Site 8 309 2 3
Genomic Location:
Chromosome 13 (position 21800188)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTATTGCATTCATTATAATTATTAATTTATTTTAAATTTGTCATTTTA[G/A]ATGCTACTGCTAAAACATCTGGAAGTGGAGCTGTATCCAGAAGCGCAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t2jgk5pq