sh2d4b

Ensembl ID:
ENSDARG00000069374
ZFIN ID:
ZDB-GENE-090313-53
Description:
Novel protein similar to human and mouse SH2 domain containing 4B (SH2D4B) [Source:UniProtKB/TrEMBL;
Human Orthologue:
SH2D4B
Human Description:
SH2 domain containing 4B [Source:HGNC Symbol;Acc:31440]
Mouse Orthologue:
Sh2d4b
Mouse Description:
SH2 domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:1925182]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31920 Nonsense Available for shipment Available now
sa2711 Nonsense F2 line generated During 2017
sa11975 Nonsense Available for shipment Available now
sa7371 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100895 Nonsense 100 450 2 8
ENSDART00000144045 Nonsense 100 441 2 7

The following transcripts of ENSDARG00000069374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 21744042)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21473380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCATACGAGCTGATTGTCAAAGAGCTGATGGAGGAAAGAGCCAGGCGA[C/T]AGGCTCAACTAGAAGCCCAGGAGCTCTGGTAAGGACTAGGACCAACTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2711
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100895 Nonsense 136 450 3 8
ENSDART00000144045 Nonsense 136 441 3 7

The following transcripts of ENSDARG00000069374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 21744440)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21473778
KASP Assay ID:
554-3316.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGASATGCCAWCACAAAGGAAAAAGCGCGCCTAGTTGCAGGCAAGTG[G/A]AAGGAAGAAGCAGAGGACAGGAAGGCAGCCAAGCAGGAAGAGGAACGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11975
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100895 Nonsense 236 450 5 8
ENSDART00000144045 Nonsense 236 441 5 7

The following transcripts of ENSDARG00000069374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 21753063)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21482401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGCTGGGCAAGAGATGAGTATAAGCGTCAGTCACTRCGAGCCATWGAG[A/T]AAGGTCATGTAGCTGGTCTGAGYGGCCACTTCCAGAAACAATCCCAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100895 Missense 360 450 7 8
ENSDART00000144045 Missense 360 441 7 7

The following transcripts of ENSDARG00000069374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 21761818)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21491156
KASP Assay ID:
554-4027.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCCTAAAGGCATCATCTCTCGRGAGGACTCAGAGACCCTGCTTATGA[A/T]TGCTRCTGTGGGCTCTTTCTTGGTACGGGTCAGTGAAAGRATATGGGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link