crcp

Ensembl ID:
ENSDARG00000069373
ZFIN ID:
ZDB-GENE-060825-150
Description:
DNA-directed RNA polymerase III subunit RPC9 [Source:RefSeq peptide;Acc:NP_001038838]
Human Orthologue:
CRCP
Human Description:
CGRP receptor component [Source:HGNC Symbol;Acc:17888]
Mouse Orthologue:
Crcp
Mouse Description:
calcitonin gene-related peptide-receptor component protein Gene [Source:MGI Symbol;Acc:MGI:1100818]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23980 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100892 Nonsense 17 144 3 6
ENSDART00000121946 Nonsense 17 144 3 6

The following transcripts of ENSDARG00000069373 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 30014412)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTTTGTTGTTTGTGGCTATAGAAGTGTTCTCTACTCCACCAGGTCTA[T/A]CAGCTGCTGACAGACCTGAAAGAAAAAAGAAAGGAGATGGTTAAAAATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aortic root size: Genome-wide joint SNP and CNV analysis of aortic root diameter in African Americans: the HyperGEN study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ggmkoiih