si:ch211-140l13.3

Ensembl ID:
ENSDARG00000069370
ZFIN IDs:
ZDB-GENE-040716-1, ZDB-GENE-070705-35
Description:
T-complex protein 10 [Source:UniProtKB/TrEMBL;Acc:Q5RHA5]
Mouse Orthologues:
Gm10326, Gm9880, Tcp10b
Mouse Descriptions:
predicted gene 10326 Gene [Source:MGI Symbol;Acc:MGI:3714485]
predicted gene 9880 Gene [Source:MGI Symbol;Acc:MGI:3711246]
t-complex protein 10b Gene [Source:MGI Symbol;Acc:MGI:98542]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43517 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100889 Nonsense 616 842 8 15
ENSDART00000133977   None 202 None 5
Genomic Location (Zv9):
Chromosome 20 (position 42761619)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42832778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTCCTGCAGAGCCGTGTGGAGACCCTCGTTCAAGAGAACCAGCACCTC[C/T]AGAGGAGACTCACTATGGGCAGGAGATCCTCTGCACCTCCATCATACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link