ppp3r1b

Ensembl ID:
ENSDARG00000069360
ZFIN ID:
ZDB-GENE-040912-18
Description:
protein phosphatase 3 (formerly 2B), regulatory s1ubunit B, alpha isoform, b [Source:RefSeq peptide
Human Orthologues:
PPP3R1, PPP3R2, WDR92
Human Descriptions:
protein phosphatase 3, regulatory subunit B, alpha [Source:HGNC Symbol;Acc:9317]
protein phosphatase 3, regulatory subunit B, beta [Source:HGNC Symbol;Acc:9318]
WD repeat domain 92 [Source:HGNC Symbol;Acc:25176]
Mouse Orthologues:
Ppp3r1, Ppp3r2, Wdr92
Mouse Descriptions:
protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type I) Gene [Source:MGI
protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type II) Gene [Source:MGI
WD repeat domain 92 Gene [Source:MGI Symbol;Acc:MGI:2144224]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32769 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32769
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100869 Essential Splice Site 94 170 5 6
Genomic Location (Zv9):
Chromosome 1 (position 52071672)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50919033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTATATGAACAATCTGAATGACTGCTCGGCTTTTTCACTTGTTTTTGCA[G/A]TTGCGTTCAGGATTTACGACATGGACAAAGATGGCTACATCTCCAACGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link