LPHN2 (1 of 4)

Ensembl ID:
ENSDARG00000069356
Description:
latrophilin 2 [Source:HGNC Symbol;Acc:18582]
Human Orthologue:
LPHN2
Human Description:
latrophilin 2 [Source:HGNC Symbol;Acc:18582]
Mouse Orthologue:
Lphn2
Mouse Description:
latrophilin 2 Gene [Source:MGI Symbol;Acc:MGI:2139714]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41780 Nonsense Mutation detected in F1 DNA During 2016
sa21847 Nonsense Available for shipment Available now
sa13747 Nonsense Available for shipment Available now
sa9378 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21848 Nonsense Mutation detected in F1 DNA During 2016
sa41781 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41782 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2614 Nonsense F2 line generated During 2016
sa41783 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21849 Nonsense Available for shipment Available now
sa9239 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 36 1436 1 20
Genomic Location (Zv9):
Chromosome 11 (position 7774302)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7618405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGTTATCCCATCGACCTACGCTGTCCAGGAAGTGATGTCATCATGATC[G/T]AGACTGCTAATTACGGTCGGACAGACGACAAGATCTGTGATGCTGACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 173 1436 3 20
Genomic Location (Zv9):
Chromosome 11 (position 7798323)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7642426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATACACTTATTGAGTACAACTCGCTCGATGATTTTCAAAACTCTCGA[C/T]AGACTACGACGTATAAACTACCCCATCGGGTCGATGGCACGGGATTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 232 1436 3 20
Genomic Location (Zv9):
Chromosome 11 (position 7798502)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7642605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGGGAGGCGATTATAAATAAMGCAAACTATCATGACACTTCGCCGTA[T/G]AAGTGGGGCGGGAAAACAGACATTGACTTGGCGGTYGAYGAAAATKGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Essential Splice Site 376 1436 3 20
Genomic Location (Zv9):
Chromosome 11 (position 7798934)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7643037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACATTCTGCGCTACAATCTGGTGTTTGGGCCACCTGATCCAGCTCACGG[T/G]AAGCCCCGTCTCAAATCCGTCTAGCTGCACACACACATAGTCTCTCYCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 581 1436 7 20
Genomic Location (Zv9):
Chromosome 11 (position 7827635)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7671738
KASP Assay ID:
2260-3939.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAATAAAAAAAAAAAGCTTCAAAAGCGAGAAAGGACGTGCAGGGCATA[T/G]ATGAAGGTATATCTGTGCTACGCTACTATGGTCTTGTTTCTGTACTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41781
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Essential Splice Site 583 1436 7 20
Genomic Location (Zv9):
Chromosome 11 (position 7827642)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7671745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAAAAAAGCTTCAAAAGCGAGAAAGGACGTGCAGGGCATATATGAAG[G/A]TATATCTGTGCTACGCTACTATGGTCTTGTTTCTGTACTTCCACATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Essential Splice Site 754 1436 10 20
Genomic Location (Zv9):
Chromosome 11 (position 7833671)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7677774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTGTATTTATATCGGAGCCTGTGATTTTCACCCTGGAGCACATCGACG[T/C]GAGTGCAAGCAATAAACAAACAAAGCGATCGTAAAAGCAGCGGGATAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2614
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 904 1436 13 20
Genomic Location (Zv9):
Chromosome 11 (position 7842540)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7686643
KASP Assay ID:
554-3314.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGCAGGGATACTGCATTACTTCTTTTTGGCGTCCTTTGMCTGGATGTG[T/A]CTGGAAGGAGTTCAGCTGTATCTGATGCTGGTGGAGGTCTTTGAGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Essential Splice Site 956 1436 13 20
Genomic Location (Zv9):
Chromosome 11 (position 7842696)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7686799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGAGTGTCTGCTGCTGTAGACTTCAGGAGCTACGGGACTAAGAAAGC[G/A]TAAGTAAACGTTTCTTTGATTTCCTTTCTTTTTTTTCTGTCTATAGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 1068 1436 17 20
Genomic Location (Zv9):
Chromosome 11 (position 7866672)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7710775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTCGCTTGAACAAAAAAAAAAAATGTTCCTTTGAACTGCAGGTACGG[C/T]GAGAGTACAGCAAATGCCTCCGACACACGTACTGCTGTAGCAGGATCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 1304 1436 20 20
Genomic Location (Zv9):
Chromosome 11 (position 7881176)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7725279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGCACCACACGCATCCCCGCACACTCGAAGCCCCCCTAATCCCCCAG[C/T]GAACTCACTCGCTCCTGTACYACACGCAGGAGAGAGCGAGGCCTGAAGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link