LPHN2 (1 of 4)

Ensembl ID:
ENSDARG00000069356
Description:
latrophilin 2 [Source:HGNC Symbol;Acc:18582]
Human Orthologue:
LPHN2
Human Description:
latrophilin 2 [Source:HGNC Symbol;Acc:18582]
Mouse Orthologue:
Lphn2
Mouse Description:
latrophilin 2 Gene [Source:MGI Symbol;Acc:MGI:2139714]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21847 Nonsense Mutation detected in F1 DNA During 2014
sa13747 Nonsense Available for shipment Available now
sa9378 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21848 Nonsense Mutation detected in F1 DNA During 2014
sa2621 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18999 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2614 Nonsense F2 line generated During 2014
sa21849 Nonsense Mutation detected in F1 DNA During 2014
sa9239 Nonsense Mutation detected in F1 DNA During 2014
sa4407 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 173 1436 3 20
Genomic Location:
Chromosome 11 (position 7798323)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATACACTTATTGAGTACAACTCGCTCGATGATTTTCAAAACTCTCGA[C/T]AGACTACGACGTATAAACTACCCCATCGGGTCGATGGCACGGGATTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 232 1436 3 20
Genomic Location:
Chromosome 11 (position 7798502)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGGGAGGCGATTATAAATAAMGCAAACTATCATGACACTTCGCCGTA[T/G]AAGTGGGGCGGGAAAACAGACATTGACTTGGCGGTYGAYGAAAATKGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Essential Splice Site 376 1436 3 20
Genomic Location:
Chromosome 11 (position 7798934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACATTCTGCGCTACAATCTGGTGTTTGGGCCACCTGATCCAGCTCACGG[T/G]AAGCCCCGTCTCAAATCCGTCTAGCTGCACACACACATAGTCTCTCYCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 581 1436 7 20
Genomic Location:
Chromosome 11 (position 7827635)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAATAAAAAAAAAAAGCTTCAAAAGCGAGAAAGGACGTGCAGGGCATA[T/G]ATGAAGGTATATCTGTGCTACGCTACTATGGTCTTGTTTCTGTACTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Essential Splice Site 645 1436 8 20
ENSDART00000091550 Essential Splice Site 645 1436 8 20
Genomic Location:
Chromosome 11 (position 7830531)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAATTTAATGGAACCAGCCATTGTGAAAGTACCAGCCAGTAATATAAG[T/A]GAGTACGAGCAATGCACAGAACTAATAGAACTGACAACATATATACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Essential Splice Site 645 1436 8 20
ENSDART00000091550 Essential Splice Site 645 1436 8 20
Genomic Location:
Chromosome 11 (position 7830531)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAATTTAATGGAACCAGCCATTGTGAAAGTACCAGCCAGTAATATAAG[T/A]GAGTACGAGCAATGCACAGAACTAATAGAACTGACAACATATATACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2614
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 904 1436 13 20
Genomic Location:
Chromosome 11 (position 7842540)
KASP Assay ID:
554-3314.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGCAGGGATACTGCATTACTTCTTTTTGGCGTCCTTTGMCTGGATGTG[T/A]CTGGAAGGAGTTCAGCTGTATCTGATGCTGGTGGAGGTCTTTGAGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 1068 1436 17 20
Genomic Location:
Chromosome 11 (position 7866672)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTCGCTTGAACAAAAAAAAAAAATGTTCCTTTGAACTGCAGGTACGG[C/T]GAGAGTACAGCAAATGCCTCCGACACACGTACTGCTGTAGCAGGATCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 1304 1436 20 20
Genomic Location:
Chromosome 11 (position 7881176)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGCACCACACGCATCCCCGCACACTCGAAGCCCCCCTAATCCCCCAG[C/T]GAACTCACTCGCTCCTGTACYACACGCAGGAGAGAGCGAGGCCTGAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 1426 1436 20 20
Genomic Location:
Chromosome 11 (position 7881542)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCATCATCCCCGTCTCTAAAGACGCCTGTGTCCCCGAGGGGGACGTA[C/T]GAGAGGGACAAATGCAGCTGGTCACAAGCCKTTAAAAACAAACTATAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t4m7a85a