TBC1D24

Ensembl ID:
ENSDARG00000069339
Description:
TBC1 domain family, member 24 [Source:HGNC Symbol;Acc:29203]
Human Orthologue:
TBC1D24
Human Description:
TBC1 domain family, member 24 [Source:HGNC Symbol;Acc:29203]
Mouse Orthologue:
Tbc1d24
Mouse Description:
TBC1 domain family, member 24 Gene [Source:MGI Symbol;Acc:MGI:2443456]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5087 Nonsense Mutation detected in F1 DNA During 2014
sa9108 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126233 Nonsense 171 606 2 8
Genomic Location:
Chromosome 24 (position 40713391)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGCTGTGATTTCCTGCGTGGCAGGGCAGTTTCCGGATATCTCACACTG[T/A]CCCTCATTGCCTGCTGTGACCGCATTGATGATGCACTGGAGCCCGGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126233 Essential Splice Site 420 606 3 8
Genomic Location:
Chromosome 24 (position 40716428)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCACAGCTGCTTTTCACCACATCTACACACGGCTGCAGCCTCAAYCGG[T/C]ACACACACACANNNNTTTGTTTTTGTGAATTGTGGGGACATTACATATTTTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z1we6lhs