BCL6B

Ensembl ID:
ENSDARG00000069335
Description:
B-cell CLL/lymphoma 6, member B [Source:HGNC Symbol;Acc:1002]
Human Orthologue:
BCL6B
Human Description:
B-cell CLL/lymphoma 6, member B [Source:HGNC Symbol;Acc:1002]
Mouse Orthologue:
Bcl6b
Mouse Description:
B-cell CLL/lymphoma 6, member B Gene [Source:MGI Symbol;Acc:MGI:1278332]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34037 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100808 Essential Splice Site 54 615 2 15
Genomic Location (Zv9):
Chromosome 7 (position 21178784)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19769220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACAACACATTGTTAGTAGTACTTACATAAACATCTGTGCTTTCCCAC[A/T]GCGGGTTCTTCTACACTCTGTTTTCTCGCCGCGTGGCTGGTATTTGCGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link