LOC793236

Ensembl ID:
ENSDARG00000069333
Human Orthologues:
FMO1, FMO2, FMO3, FMO4, FMO5, FMO6P
Human Descriptions:
flavin containing monooxygenase 1 [Source:HGNC Symbol;Acc:3769]
flavin containing monooxygenase 2 (non-functional) [Source:HGNC Symbol;Acc:3770]
flavin containing monooxygenase 3 [Source:HGNC Symbol;Acc:3771]
flavin containing monooxygenase 4 [Source:HGNC Symbol;Acc:3772]
flavin containing monooxygenase 5 [Source:HGNC Symbol;Acc:3773]
flavin containing monooxygenase 6 pseudogene [Source:HGNC Symbol;Acc:24024]
Mouse Orthologues:
Fmo1, Fmo2, Fmo3, Fmo4, Fmo5, Fmo9, Gm4846, Gm4847
Mouse Descriptions:
flavin containing monooxygenase 1 Gene [Source:MGI Symbol;Acc:MGI:1310002]
flavin containing monooxygenase 2 Gene [Source:MGI Symbol;Acc:MGI:1916776]
flavin containing monooxygenase 3 Gene [Source:MGI Symbol;Acc:MGI:1100496]
flavin containing monooxygenase 4 Gene [Source:MGI Symbol;Acc:MGI:2429497]
flavin containing monooxygenase 5 Gene [Source:MGI Symbol;Acc:MGI:1310004]
flavin containing monooxygenase 9 Gene [Source:MGI Symbol;Acc:MGI:3606068]
predicted gene 4846 Gene [Source:MGI Symbol;Acc:MGI:3643319]
predicted gene 4847 Gene [Source:MGI Symbol;Acc:MGI:3643320]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30652 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100802 Nonsense 50 446 1 9
Genomic Location (Zv9):
Chromosome 10 (position 23229169)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 23000462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCCGTGCTGTTTGAAATGACCAATCATTTGGGTGGGACCTGGTTCTA[T/A]GAGGAACGAGTGGGTACATATGACAATGGGTATCCCATCCACAGCAGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lentiform nucleus volume : Genome-wide association identifies genetic variants associated with lentiform nucleus volume in N = 1345 young and elderly subjects. (View Study)
  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link