LOC792697

Ensembl ID:
ENSDARG00000069331
Human Orthologue:
TRIP6
Human Description:
thyroid hormone receptor interactor 6 [Source:HGNC Symbol;Acc:12311]
Mouse Orthologue:
Trip6
Mouse Description:
thyroid hormone receptor interactor 6 Gene [Source:MGI Symbol;Acc:MGI:1343458]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20902 Nonsense Mutation detected in F1 DNA During 2014
sa20901 Nonsense Mutation detected in F1 DNA During 2014
sa17712 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100798 Nonsense 86 570 2 9
Genomic Location:
Chromosome 7 (position 21149351)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCCATGCAACACCAGCATCCAGATGATCGCTCAGGGTCTGCCACATA[T/A]CATCAGTTGACCCCCCAGTTAGGAGACCGATACTATGCCCCAGGGCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100798 Nonsense 151 570 3 9
Genomic Location:
Chromosome 7 (position 21147054)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTCTCTTACATGCATGCTGGCAGACCTGGACAGCCACCCTCAGAGCT[C/G]AAGCACACAGGTAAAACACATCTATGCTGACATGTCACATGATCCTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100798 Essential Splice Site 527 570 8 9
Genomic Location:
Chromosome 7 (position 21141733)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATCGTTGCACTGGATCGCAGTTTCCATGTTAACTGTTACGTATGTGAG[G/A]TAAGGATTTTTACACWTGAGTTTATTTTATGTGGAAGTACATATAWAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t0kb6mvq