drgx

Ensembl ID:
ENSDARG00000069329
ZFIN ID:
ZDB-GENE-070330-1
Description:
dorsal root ganglia homeobox protein [Source:RefSeq peptide;Acc:NP_001032182]
Human Orthologue:
DRGX
Human Description:
dorsal root ganglia homeobox [Source:HGNC Symbol;Acc:21536]
Mouse Orthologue:
Prrxl1
Mouse Description:
paired related homeobox protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:2148204]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11912 Essential Splice Site Available for shipment Available now
sa11880 Essential Splice Site Available for shipment Available now
sa12024 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100795 Essential Splice Site 182 287 5 6
ENSDART00000133138 Essential Splice Site 182 287 6 7
ENSDART00000100795 Essential Splice Site 182 287 5 6
ENSDART00000133138 Essential Splice Site 182 287 6 7
ENSDART00000100795 Essential Splice Site 182 287 5 6
ENSDART00000133138 Essential Splice Site 182 287 6 7
Genomic Location (Zv9):
Chromosome 13 (position 31139457)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30785405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACAGCCACTTACGCGCAAGCTTTATCACAAGTGGCAACTTTAAAAGG[T/A]AAGMCCCGCCATACTGAATGCCATCRTRAAAACATTTAYGGMTGTTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100795 Essential Splice Site 182 287 5 6
ENSDART00000133138 Essential Splice Site 182 287 6 7
ENSDART00000100795 Essential Splice Site 182 287 5 6
ENSDART00000133138 Essential Splice Site 182 287 6 7
ENSDART00000100795 Essential Splice Site 182 287 5 6
ENSDART00000133138 Essential Splice Site 182 287 6 7
Genomic Location (Zv9):
Chromosome 13 (position 31139457)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30785405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACAGCCACTTACGCGCAAGCTTTATCACAAGTGGCAACTTTAAAAGG[T/A]AAGMCCCGCCATACTGAATGCCATCRTRAAAACATTTAYGGMTGTTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100795 Essential Splice Site 182 287 5 6
ENSDART00000133138 Essential Splice Site 182 287 6 7
ENSDART00000100795 Essential Splice Site 182 287 5 6
ENSDART00000133138 Essential Splice Site 182 287 6 7
ENSDART00000100795 Essential Splice Site 182 287 5 6
ENSDART00000133138 Essential Splice Site 182 287 6 7
Genomic Location (Zv9):
Chromosome 13 (position 31139457)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30785405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACAGCCACTTACGCGCAAGCTTTATCACAAGTGGCAACTTTAAAAGG[T/A]AAGMCCCGCCATACTGAATGCCATCRTRAAAACATTTAYGGMTGTTTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Inflammatory biomarkers: A genome-wide association study of inflammatory biomarker changes in response to fenofibrate treatment in the Genetics of Lipid Lowering Drug and Diet Network. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link